You can use samtools view to view a CRAM file just as you would for aīAM file. samtools view -T genome/chrX.fa -C -o eg/ERR188273_chrX.cram eg/ERR188273_chrX.bam
Use samtools view with the -TĪnd -C arguments to convert a BAM file into CRAM. samtools view -b eg/ERR188273_chrX.sam > eg/my.bam Input format is auto-detected, so we no longer need the -S parameter.
If the header information is available, we can convert a SAM file intoīAM by using samtools view -b. # ERR188273.14904746 99 chrX 251271 60 75M = 251317 121 GAAAAATGGGCCCAGGGGACCGGCGCTCAGCATACAGAGGACCCGCGCCGGCACCTGCCTCTGAGTTCCCTTAGT aln.bam
# ERR188273.4711308 133 chrX 21649 0 * = 21649 0 CTACAGGTGCCCGCCACCATGCCCAGCTAATTTTTTTTGTATTTTTAGTAGAGATGGGGTTTCACTGTGTTGGCC YT:Z:UP # ID:samtools PN:samtools PP:hisat2 VN:1.14 CL:samtools view -h eg/ERR188273_chrX.bam Notice that the SAM file is much larger than the BAM file. Recommend storing only sorted BAM files as they use even less disk spaceĪnd are faster to process. SAM file contains the sequence header information. I don’t have a SAM file in the example folder, so let’s create one andĬheck out the first ten lines. # help display this help message or help for Ī BAM file is just a SAM file but stored in binary format you shouldĪlways convert your SAM files into BAM format since they are smaller in # samples list the samples in a set of SAM/BAM/CRAM files # depad convert padded BAM to unpadded BAM # ampliconstats generate amplicon specific stats # coverage alignment depth and percent coverage # import Converts FASTA or FASTQ files to SAM/BAM/CRAM # quickcheck quickly check if SAM/BAM/CRAM file appears intact # collate shuffle and group alignments by name # ampliconclip clip oligos from the end of reads # targetcut cut fosmid regions (for fosmid pool only) # calmd recalculate MD/NM tags and '=' bases # Program: samtools (Tools for alignments in the SAM format) help, all the available utilities are listed: samtools -help If you run samtools on the terminal without any parameters or with
#Bam file format install
Once you have installed Miniconda, you can install SAMtools as follows: conda install -c bioconda samtools For example: # clone this repoĭocker run -rm -it -v $(pwd):/work davetang/r_build:4.1.2 /bin/bashįor installing SAMtools, I recommend using Conda and the BiocondaĪnaconda because Anaconda comes with a lot of tools/packages that you Script if you want to generate this file yourself, please use thisĪnd the Makefile in this directory. This README is generated using the create_readme.sh (stored in the eg folder) generated as per The examples in this README use the ERR188273_chrX.bam BAM file Latest information on SAMtools, please refer to the release High-throughput sequencing data, at some point you will probably have toĭeal with SAM/BAM files, so familiarise yourself with them! For the The SAM (Sequence Alignment/Map) format (BAM is just theīinary form of SAM) is currently the de facto standard for storing SAMtools provides various (sub)tools for manipulating alignments in the